Plasma free serotonin as a marker for early detection of breast cancer recurrence.

AIM: To evaluate the significance of plasma free serotonin (5-hydroxytryptamine) and Ca15.3 for the early detection of breast cancer recurrence. MATERIALS AND METHODS: Free serotonin and Ca15.3 levels were measured by I-125-Serotonin RIA (DDV Diagnostica, Marburg, Germany) in plasma and an ELISA kit (Roche Diagnostic GmbH, Mannheim, Germany) in serum, respectively in women (N=29) who responded to primary treatment for breast cancer and who were followed-up for recurrence. For analysis, patients were sub-divided according to TNM staging into groups with localized (T1-2N0-M0) and advanced (T1-2N1-2M0-1) disease. The control group were healthy blood donors. RESULTS: Patients with advanced disease had a significantly higher plasma serotonin level than those with localized disease or controls, whereas Ca15.3 levels remained in normal range in all groups. At the time of serotonin measurement, radiological findings were negative for all patients in the localized-disease group, but positive in nine patients in the advanced-disease group. CONCLUSION: Plasma free serotonin may be used for the early detection of recurrent/metastatic breast cancer disease, but validation on a larger number of patients is needed.

Detection of cytokeratin-20-positive cells in preoperative and postoperative blood samples from colorectal cancer patients by real-time RT-PCR.

BACKGROUND: Detection of circulating cancer cells by reverse transcription polymerase chain reaction (RT-PCR) has been studied as a prognostic marker in patients with colorectal cancer (CRC) but so far with conflicting results regarding specificity and prognostic value. In this study cytokeratin-20 (CK20) was evaluated by real-time RT-PCR as a marker for circulating CRC cell detection and the influence of surgical tumor resection on the presence of circulating CRC cells was analyzed. METHODS: RNA was isolated from the mononuclear cell fraction of blood samples taken from 95 CRC patients before and after tumor resection and from 23 healthy volunteers and assayed by real-time RT-PCR for CK20 expression. RESULTS: Among 23 healthy volunteers one was positive for CK20. Among 95 CRC patients, 25 were positive for CK20 before and 23 after surgery. Sixteen patients positive before surgery became negative after surgery, while 14 patients negative before surgery became positive after surgery. An increase in the proportion of CK20-positive samples with increasing stage of disease was observed for preoperative but not postoperative blood samples. CONCLUSIONS: Its association with clinical stage indicates that CK20 might have prognostic value as a marker for detection of circulating CRC cells. Surgical tumor resection can both reduce and induce the presence of circulating CRC cells.

Salivary and serum interleukin 1 beta, interleukin 6 and tumor necrosis factor alpha in patients with leukoplakia and oral cancer

Objectives: The aim of study was to compare salivary and serum concentrations of interleukin 1 beta (IL-1Beta), interleukin 6 (IL-6) and tumor necrosis factor alpha (TNF-Alpha) in patients with oral leukoplakia, oral cancer and healthy controls. Study design: Eighty eight patients (28 with oral cancer, 29 leukoplakia, and 31 healthy controls) were included in this study. Cytokine concentrations were measured by commercial enzyme linked immunoassay. Results: Salivary IL-1Beta and IL-6 were significantly higher in oral cancer patients than in patients with leukoplakia and control group (p<0.05). No differences in concentrations of salivary TNF-Alpha between either of the groups were observed. Serum concentrations of IL-1Beta were below level of detection in all but two participants. No significant differences between the groups were observed in serum concentrations of IL-6. Serum TNF-Alpha was significantly higher in control subjects than in oral cancer patients. Conclusions: Patients with oral cancer have elevated levels of inflammatory cytokines in their saliva. Whether this elevation can be used for monitoring the malignant transformation of oral leukoplakia remains to be answered by further follow up studies (AU)

Determination of leucocyte subsets in human saliva by flow cytometry.

OBJECTIVE: Validation of a flow cytometry-based method for the determination of major leucocyte subsets [polymorphonuclear (PMN) cells, monocytes, T cells and B cells] in paraffin-stimulated whole human saliva. DESIGN: Salivary leucocyte subsets were determined by four-colour flow cytometry in eight healthy volunteers on three consecutive days. Comparison of leucocyte subsets between saliva and whole blood was also performed. Day-to-day variability and intraclass correlation coefficients (ICC) were determined as indicators of assay reliability. RESULTS: It was observed that PMN cells were the predominant cells in the saliva. Percentages of mononuclear cells ranged from 0.3% to 7.2%, with monocytes composing the highest percentage, followed by T cells and B cells. Regardless of high intra-individual day-to-day variability, proportions of leucocyte subsets did not significantly change over three measurements, and high ICCs were calculated for T cells and monocytes. CONCLUSION: Flow cytometry can be used as non-invasive and reproducible method for the analysis of leucocyte subsets in human saliva. Further investigation of pathological and other conditions that have the potential to influence salivary leucocyte subsets is warranted.

Salivary and serum interleukin 1 beta, interleukin 6 and tumor necrosis factor alpha in patients with leukoplakia and oral cancer.

OBJECTIVES: The aim of study was to compare salivary and serum concentrations of interleukin 1 beta (IL-1ß), interleukin 6 (IL-6) and tumor necrosis factor alpha (TNF-α) in patients with oral leukoplakia, oral cancer and healthy controls. STUDY DESIGN: Eighty eight patients (28 with oral cancer, 29 leukoplakia, and 31 healthy controls) were included in this study. Cytokine concentrations were measured by commercial enzyme linked immunoassay. RESULTS: Salivary IL-1ß and IL-6 were significantly higher in oral cancer patients than in patients with leukoplakia and control group (p<0.05). No differences in concentrations of salivary TNF-α between either of the groups were observed. Serum concentrations of IL-1ß were below level of detection in all but two participants. No significant differences between the groups were observed in serum concentrations of IL-6. Serum TNF-α was significantly higher in control subjects than in oral cancer patients. CONCLUSIONS: Patients with oral cancer have elevated levels of inflammatory cytokines in their saliva. Whether this elevation can be used for monitoring the malignant transformation of oral leukoplakia remains to be answered by further follow up studies.

Galectin-3 and CD44v6 as markers for preoperative diagnosis of thyroid cancer by RT-PCR.

The aim of the study was to determine the diagnostic value of reverse transcriptase polymerase chain reaction (RT-PCR) analysis of galectin-3 and CD44v6 as markers for preoperative diagnosis of malignancy in lesions of the thyroid. RT-PCR analysis of galectin-3 and CD44v6 expression was performed on RNA isolated from fine-needle aspirates of thyroid lesions from 428 patients. The results were evaluated against the postoperative histopathological diagnosis or definitive cytological diagnosis in cases of nodular goiter and Hashimoto thyroiditis. A total of 57 (13%) samples were inadequate for RT-PCR. Galectin-3 and CD44v6 were positive in 167 (45%) and 158 (43%) out of 371 adequate samples, respectively. Galectin-3 and CD44v6 were positive in 56 (86%) and 54 (83%) out of 65 papillary carcinomas, in 16 (29%) and 18 (32%) out of 56 Hashimoto's thyroiditis, in 61 (34%) and 52 (29%) out of 181 nodular goiters, in 23 (43%) and 23 (43%) out of 53 follicular adenomas, in 3 (100%) and 3 (100%) out of 3 follicular carcinomas, and in 8 (62%) and 8 (62%) out of 13 Hurthle cell adenomas, respectively. Specificity, sensitivity, and positive and negative predictive values in discriminating between malignant and benign thyroid nodules were 64, 87, and 35 and 96% for galectin-3; 67, 84, and 36 and 95% for CD44v6; and 79, 82, and 47 and 95% for the analysis of both markers (considered positive only if both galectin-3 and CD44v6 were positive), respectively. Owing to relatively low specificity, the clinical value of galectin-3 and CD44v6 analysis by RT-PCR as a marker for preoperative diagnosis of malignancy in thyroid lesions is limited.

Effects of low-level laser treatment on mouth dryness.

UNLABELLED: Mouth dryness (MD) is usually followed by inadequate mechanical cleaning of the mouth and decrease in the levels of salivary antimicrobial proteins (including secretory immunoglobulin A (sIgA)). It is accompanied by difficulties during speaking and food swallowing, with an unpleasant taste, burning sensations in the mouth and higher susceptibility to oral diseases. Low-level laser treatment (LLLT) can intensify cell metabolism and its application on salivary glands could improve salivation. The purpose of this study was to evaluate the effects of LLLT on salivation of patients suffering from MD. The study included 17 patients with MD. Their major salivary glands were treated with low intensity laser BTL2000 on 10 occasions. The whole unstimulated and stimulated saliva quantities were measured just before the 1st, after the 10th and thirty days following the last (10th) treatment. In the samples of unstimulated saliva concentrations of sIgA were estimated by using ELISA method and its quantity in the time unit was calculated. The visual analogue scale (VAS) score was used to assess burning and/or pain intensity at these three time points. Statistical tests revealed significant salivation improvement quantitatively and qualitatively, i.e. increase in the quantity of saliva and sIgA. VAS score was also significantly improved and no side effects were observed. CONCLUSIONS: According to the results of this study, application of LLLT to xerostomic patients' major salivary glands stimulates them to produce more saliva with better antimicrobial characteristics and improves the difficulties that are associated with MD. This simple non-invasive method could be used in everyday clinical practice for the treatment of MD.

Salivary and serum levels of substance P, neurokinin A and calcitonin generelated peptide in burning mouth syndrome

Background: Burning mouth syndrome (BMS) is an enigmatic condition with the etiopathogenesis remaininglargely obscure. However, a neuropathic basis for BMS continues to be an area of active clinical and researchinterest.Aim: It is becoming increasingly evident that certain oral disorders may be modulated by imbalances in certainneuropeptides such as substance P (SP), neurokinin A (NKA) and calcitonin gene-related peptide (CGRP) thereforewe measured SP, NKA and CGRP in the saliva and sera of BMS patients as well as controls.Subjects and Methods: Salivary and serum SP, NKA and CGRP were determined in the 26 female patients withburning mouth syndrome (age range 51-78, mean 65.69 yrs), and in the 22 female controls (age range 24-82, mean49.72 yrs). Serum and salivary SP, NKA, CGRP levels were determined by commercial competitive enzyme immunoassaykits. Statistical analysis was performed by use of descriptive statistics and analysis of variance.Results and Conclusions: No significant differences in salivary SP, NKA and CGRP as well as serum SP andCGRP between BMS patients and controls could be found. However, significantly decreased serum neurokinin A(p<0.05) in BMS patients may reflect an inefficient dopaminergic system (AU)

No disponible

Prognostic value of microphthalmia-associated transcription factor and tyrosinase as markers for circulating tumor cells detection in patients with melanoma.

The aim of this study was to analyze microphthalmia-associated transcription factor (MITF) as a marker for the detection of circulating melanoma cells, determine its prognostic value in melanoma patients, and compare it with tyrosinase. Blood samples from 201 melanoma patients in all stages of the disease and 40 healthy volunteers were analyzed. RNA was isolated from mononuclear cell fraction of the blood and assayed by reverse transcription-PCR for the expression of MITF and tyrosinase. All samples from healthy volunteers were negative for both MITF and tyrosinase. Out of 201 blood samples from melanoma patients 32 were positive for MITF, 20 for tyrosinase, and four for both MITF and tyrosinase. Analysis of MITF as an additional marker to tyrosinase allowed for detection of circulating melanoma cells in a larger number of melanoma patients in comparison to tyrosinase analysis alone (48 vs. 20 positive). A positive value of MITF was associated with shorter progression-free (P=0.005) and overall survival (P=0.042). A positive value of tyrosinase was associated with shorter overall survival (P=0.012), whereas there was no significant association between the value of tyrosinase and progression-free survival. The value of MITF was selected with multivariate analysis as the independent prognostic factor for progression-free survival, whereas the only independent prognostic factor for overall survival was the stage of disease. This study has shown that MITF is a specific marker for detection of circulating melanoma cells that has a prognostic value in melanoma patients. Determination of MITF in addition to tyrosinase improved the detection of circulating melanoma cells in melanoma patients.

Salivary and serum levels of substance P, neurokinin A and calcitonin gene related peptide in burning mouth syndrome.

BACKGROUND: Burning mouth syndrome (BMS) is an enigmatic condition with the aetiopathogenesis remaining largely obscure. However, a neuropathic basis for BMS continues to be an area of active clinical and research interest. AIM: It is becoming increasingly evident that certain oral disorders may be modulated by imbalances in certain neuropeptides such as substance P (SP), neurokinin A (NKA) and calcitonin gene-related peptide (CGRP) therefore we measured SP, NKA and CGRP in the saliva and sera of BMS patients as well as controls. SUBJECTS AND METHODS: Salivary and serum SP, NKA and CGRP were determined in the 26 female patients with burning mouth syndrome (age range 51-78, mean 65.69 yrs), and in the 22 female controls (age range 24-82, mean 49.72 yrs). Serum and salivary SP, NKA, CGRP levels were determined by commercial competitive enzyme immunoassay kits. Statistical analysis was performed by use of descriptive statistics and analysis of variance. RESULTS AND CONCLUSIONS: No significant differences in salivary SP, NKA and CGRP as well as serum SP and CGRP between BMS patients and controls could be found. However, significantly decreased serum neurokinin A (p<0.05) in BMS patients may reflect an inefficient dopaminergic system.

Thyroid fine-needle aspiration samples inadequate for reverse transcriptase-polymerase chain reaction analysis.

BACKGROUND: Analysis of different tumor markers by reverse transcriptase-polymerase chain reaction (RT-PCR) in fine-needle aspiration samples of thyroid nodules has been studied with the objective of improving the accuracy of the preoperative diagnosis of thyroid lesions. The aim of the current study was to investigate thyroid fine-needle aspiration samples inadequate for RT-PCR analysis and to determine whether there is a correlation between their proportion and the method of sampling used or the greatest dimension of the nodules. METHODS: A total of 350 fine-needle aspiration samples from patients with thyroid nodules were analyzed. After the aspirate was smeared for conventional cytology, the leftover material in the needle was used for RT-PCR analysis in 1 group of 175 patients. In another group of 175 patients, a separate puncture was performed to obtain material for RT-PCR analysis only. Samples were considered adequate for RT-PCR analysis if the expression of both glyceraldehyde-3-phosphate dehydrogenase and thyroglobulin was found by RT-PCR. RESULTS: In total, 61 (17.4%) samples inadequate for RT-PCR were detected. All 12 samples that were inadequate for cytologic diagnosis were also found to be inadequate for RT-PCR analysis. The proportion of inadequate samples for RT-PCR was found to be significantly higher in samples taken from leftover material in the needle (21.7%) then in samples from a separate puncture (13.1%) (P = .049). No statistically significant correlation between the adequacy of samples for RT-PCR and the largest dimension of the nodule was found. CONCLUSIONS: The proportion of samples inadequate for RT-PCR was found to be higher in samples taken from leftover material in the needle than in samples obtained from a separate puncture.

Modulating role of alcohol and acetaldehyde on neutrophil and monocyte functions in vitro.

Moderate alcohol intake lowers coronary heart disease risk. Because polymorphonuclear neutrophils (PMN) and monocytes (Mo) play a role in atherosclerotic plaque destabilization we investigated in vitro effects of clinically relevant concentrations of ethanol (0.05, 0.125, 0.25, and 0.5%) and its metabolite acetaldehyde (0.0625, 0.125, and 0.5 mM) on human PMN and Mo phagocytic functions. PMN and Mo from healthy volunteers were separated and purified according standard methods and the following parameters were determined: phagocytic activity (percent of phagocytes with at least one ingested particle), ingestion index (number of ingested particles per 100 phagocytic cells), and intracellular killing (percent of dead ingested particles per 100 phagocytes) using acridine orange method and living yeast cells as targets. Reactive oxygen species (ROS) formation of ethanol-treated PMN and Mo was evaluated using 2,7-dichlorofluorescin method and results were expressed as percent of fluorescence-positive cells. Ethanol and acetaldehyde significantly reduced PMN phagocytic functions, with the exception of phagocytic activity, starting at 0.125% for ethanol and 0.0625 mM for acetaldehyde. Mo ingestion and microbicidity were decreased at ethanol concentrations of 0.5% without effect on Mo phagocytic activity. Acetaldehyde impaired Mo ingestion ability starting at 0.0625 mM and phagocytic activity at 0.5 mM while was without effect on Mo microbicidity. ROS production was significantly increased at ethanol concentrations 0.25 and 0.5% in PMN and at 0.5% in Mo. These results might partly explain the beneficial role of moderate use of alcohol on cardiovascular disease.

Preoperative serum levels of c-erbB-2 do not seem to be useful in management of patients with rectal cancer.

BACKGROUND AND AIM: Soluble c-erbB-2 oncoprotein has been proven as a useful marker in the management of breast cancer patients, but its value in diagnostics and follow-up of colorectal cancer patients remains controversial. The aim of this study was to evaluate the usefulness of serum c-erbB-2 monitoring in diagnostics and prediction of disease outcome in rectal cancer patients. MATERIALS AND METHODS: Serum samples from 88 patients with rectal adenocarcinoma before surgery and from 41 healthy controls were tested for the presence of c-erbB-2 oncoprotein by ELISA, and the patients were followed up for at least 5 years after the surgery. RESULTS: Preoperative serum c-erbB-2 levels were significantly higher in stage IV patients than in healthy controls (P<0.001) and did not show correlation with preoperative CEA levels. Elevated preoperative serum c-erbB-2 levels showed relatively high specificity (88%) and low sensitivity (44%) in the diagnosis of rectal cancer. Elevated preoperative oncoprotein levels were predictive neither for overall survival nor for development of local recurrence/distant metastases. CONCLUSION: Although preoperative serum c-erbB-2 levels were significantly higher in rectal cancer patients than in healthy controls, the soluble c-erbB-2 does not seem to be useful in the diagnosis of rectal cancer due to its low sensitivity. Preoperative serum levels of this oncoprotein were predictive neither for overall survival nor for local recurrence/distant metastases in rectal cancer patients.

Detection of disseminated melanoma cells by reverse-transcription - polymerase chain reaction.

Detection of circulating melanoma cells by reverse transcriptase - polymerase chain reaction (RT-PCR) is a molecular diagnostic procedure which is used to predict prognosis in melanoma patients. The most widely used specific marker for detection of circulating melanoma cells by RT-PCR is expression of tyrosinase gene. This procedure has shown high specificity and low threshold for detection of melanoma cells. Most of the studies have shown that prognosis is worse in patients in which circulating melanoma cells were detected. Detection of circulating melanoma cells has been studied also as a marker for predicting response to therapy. The clinical value of this procedure is limited by the proportion of patients with clinically confirmed distant metastases being tyrosinase negative in almost all the studies. Studies have shown that analysis of additional markers to tyrosinase enables detection of circulating melanoma cells in a higher percentage of melanoma patients. RT-PCR has shown a lower threshold for detection than other methods (immunohistochemistry) in detection of melanoma metastases in lymph nodes.

Serum autoantibodies to desmogleins 1 and 3 in patients with oral lichen planus.

AIM: To determine the presence of circulating autoantibodies to desmoglein (Dsg) 1 and Dsg 3 in patients with oral lichen planus. METHODS: Serum concentrations of circulating autoantibodies to Dsg 1 and Dsg 3 were determined by ELISA in 32 patients with erosive form and 25 patients with reticular form of oral lichen planus, 13 patients with acute recurrent aphthous ulcerations and 50 healthy controls. Indirect immunofluorescence analysis was also performed. RESULTS: Concentrations of circulating autoantibodies to both Dsg 1 and Dsg 3 detected in the sera of patients with erosive form of oral lichen planus were significantly increased in comparison with those in healthy controls, patients with recurrent aphthous ulceration, and those with reticular oral lichen planus (P<0.001 for both anti-Dsg autoantibodies). Indirect immunofluorescence also revealed significantly more positive findings in patients with erosive oral lichen planus (18 positive of 22 tested) than in healthy controls (1 positive of 20 tested; P<0.001), patients with recurrent aphthous ulceration (1 positive of 10 tested; P<0.001), and those with reticular oral lichen planus (3 positive of 15 tested; P<0.001). CONCLUSION: Humoral autoimmunity seems to be involved in the pathogenesis of oral lichen planus. The differences in the serum concentration of desmoglein autoantibodies suggested that pathological mechanisms in erosive and reticular forms of oral lichen planus might not be the same.

The immunomodulation effect of allogenic blood transfusion in colorectal cancer--a new approach.

The total number of 542 patients with colorectal cancer surgery have been analyzed in order to estimate the effect of receiving transfusion local recurrences, and the disease free - survival. It should be examined whether there are changes in general immunity indicators which would be connected with perioperative transfusion. A significant connection has been found between local recurrences and blood transfusion (p<0.0001), the most noticeable being in Dukes A (p =0.045), localization on rectum (p=0.036). The receiving of blood transfusion is linked significantly with disease free - survival reduction (p =0.0068; log rank), the most significant being in Dukes A stage (p =0.0123; log rank) and with localization on rectum (p=0.0231). The analysis of general immunity indicators has shown significant immunocompromitation of patients just before the surgery and this could have effect on immunomodulation caused by transfusion and just as on the treatment prognosis of colorectal carcinoma.

The significance of salivary and serum interleukin 6 and basic fibroblast growth factor levels in patients with Sjögren's syndrome.

Role of various cytokines have been implicated in the development and perpetuation of Sjogren's syndrome (SS), but no specific cytokine could be determined as a major contributor to the SS. Salivary and serum interleukin 6 (IL-6) levels have been studied previously in patients with SS, but data upon salivary and serum basic fibroblast growth factor (bFGF) in SS are lacking. The aim of this study was to evaluate levels of salivary and serum IL-6 and bFGF in 18 patients with SS, age range 32-79, mean 54.05 years. Control group consisted of 23 healthy participants, mean age 25 years. Serum IL-6 and bFGF levels were not significantly different between patients with SS and healthy controls. Elevated levels of salivary IL-6 and bFGF in patients with SS when compared to the healthy controls were found (p<0.001). We might speculate that higher levels of salivary IL-6 and bFGF in patients with SS might originate from local production probably having source in the salivary glands.

Immunocompetence in non-seminomatous testicular cancer patients before any treatment and one year after completion of therapy.

BACKGROUND: Assessment of immunocompetence in non-seminomatous testicular cancer (NSTC) patients. MATERIALS AND METHODS: In the peripheral blood of 43 patients with NSTC, lymphocyte subsets, lymphocyte reactivity to mitogens, NK cell activity as well as neutrophil and monocyte phagocytic functions were studied. RESULTS: The proportion and number of T- and B- lymphocytes, lymphocyte reactivity to mitogens as well as neutrophil and monocyte phagocytic functions were equal in patients with localized disease and in those with metastatic disease and they not differ from those in controls. The NK cell number and NK cell activity, however, were significantly impaired in both patient groups. The patients with metastatic disease had a lower NK cell activity than those with localized disease. One year after the completion of anticancer treatment, the NK cell number and cytotoxic activity recovered in both groups of patients. CONCLUSION: These results suggest that patients with NSTC are primarily deficient in NK cell number and their cytotoxic function influence the host's ability to control the proliferation and spread of tumor cells.

Status of the DPC4 tumor suppressor gene in sporadic colon adenocarcinoma of Croatian patients: identification of a novel somatic mutation.

Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.

Microphthalmia-associated transcription factor and tyrosinase as markers of melanoma cells in blood of patients with melanoma.

AIM: To investigate whether analysis of microphthalmia-associated transcription factor (MITF) as an additional marker to tyrosinase in melanoma patients can improve the detection of circulating melanoma cells by reverse-transcription-polymerase chain reaction (RT-PCR). METHODS: Blood samples were taken from 33 patients with metastatic melanoma. RNA was isolated from mononuclear cell fraction of the blood and reversely transcribed into the complementary DNA (cDNA). The cDNA was assayed by PCR for the expression of tyrosinase and MITF. Peripheral blood samples from 15 healthy subjects were used as controls. RESULTS: The threshold for detection of both tyrosinase and MITF was set low enough to detect 50 melanoma cells in 10 mL of healthy volunteer blood in the relative ratio of one melanoma cell in 0.82 x 106 peripheral blood leukocytes. Out of 33 blood samples from metastatic melanoma patients, 5 were positive for both tyrosinase and MITF, 7 for tyrosinase only, and 5 for MITF only. All samples from healthy volunteers were negative for both tyrosinase and MITF. CONCLUSION: Determination of MITF marker in addition to tyrosinase improved the detection of circulating melanoma cells in patients with metastatic melanoma.